Go to Top Go to Bottom
Anim Biosci > Volume 37(1); 2024 > Article
Jiang, Zhang, Wang, Ge, Sun, Li, Miao, and Zhu: Effects of enzymolysis and fermentation of Chinese herbal medicines on serum component, egg production, and hormone receptor expression in laying hens

Abstract

Objective

In the present study, we aimed to investigate the effects of enzymolysis fermentation of Chinese herbal medicines (CHMs) on egg production performance, egg quality, lipid metabolism, serum reproductive hormone levels, and the mRNA expression of the ovarian hormone receptor of laying hens in the late-laying stage.

Methods

A total of 360 Hy-Line Brown laying hens (age, 390 days) were randomly categorized into four groups. Hens in the control (C) group were fed a basic diet devoid of CHMs, the crushed CHM (CT), fermented CHM (FC), and enzymatically fermented CHM (EFT) groups received diets containing 2% crushed CHM, 2% fermented CHM, and 2% enzymatically fermented CHM, respectively.

Results

Compared with crushed CHM, the acid detergent fiber, total flavonoids, and total saponins contents of fermented CHM showed improvement (p<0.05); furthermore, the neutral and acid detergent fiber, total flavonoids, and total saponins contents of enzymatically fermented CHM improved (p<0.05). At 5 to 8 weeks, hens in the FC and EFT groups showed increased laying rates, haugh unit, albumin height, yolk color, shell thickness, and shell strength compared with those in the C group (p<0.05). Compared with the FC group, the laying rate, albumin height, and Shell thickness in the EFT group was increased (p<0.05). Compared with the C, CT, and FC groups, the EFT group showed reduced serum total cholesterol and increased serum luteinizing hormone levels and mRNA expressions of follicle stimulating hormone receptor and luteinizing hormone receptor (p<0.05).

Conclusion

These results indicated that the ETF group improved the laying rate and egg quality and regulated the lipid metabolism in aged hens. The mechanism underlying this effect was likely related to cell wall degradation of CHM and increased serum levels of luteinizing hormone and mRNA expression of the ovarian hormone receptor.

INTRODUCTION

The late egg-laying period is characterized by the gradual deterioration of lipid metabolic functions, which contributed to decreased egg production performance and potential health problems in laying hens [1]. Furthermore, the luteinizing hormone (LH) and ovarian hormone receptor mRNA expression directly affected egg-laying rates in hens [2]. Therefore, safe feed additives to maintain egg production performance during the late-laying period are necessary.
Chinese herbal medicines (CHMs) have bacteriostatic, antiviral, and immune-enhancing effects and their merits are that they are safe, effective, and abundant [3]. The use of CHM is a whole concept, single CHM in practical application cannot reach the effect. Multiple interactions of CHMs are needed to enhance their effectiveness. Astragalus and Angelica sinensis predominantly improve the weakened cardiovascular function caused by aging and enhance immunity. Alpinia oxyphylla and Wolfiporia extensa Ginns can tonify kidney and spleen, and strengthen the regulation of the whole function. After adequately improving the body functions, Leonurus japonicus acts on reproductive organs and regulates egg production performance. Chinese hawthorn and dandelion can increase appetite, harmonize the nature of the drug, and reduce the toxicity of the formula. CHMs predominantly function via the effects of intracellular active ingredients to balance the internal environment, unblock the Zhangfu organ meridians, inhibit pathogens, and control diseases [4]. However, total flavonoids, crude polysaccharides, and other active ingredients may not be completely released because they are protected by the hard cell wall [5], which reduces the efficacy. Therefore, the enzymatic fermentation of CHMs has garnered considerable attention. Enzymolysis fermentation are performed using CHMs as a substrate, with the addition of compound enzymes and probiotics for synergistic fermentation. In the enzymatically fermented CHM system, enzymes can degrade cellulose, hemicellulose, and pectin in the cell walls of CHMs [6], thereby releasing intracellular active ingredients. Nonetheless, the degradation ability of enzymes is related to the enzyme source and its combinations as well as whether the fermentation environment is conducive to enzymatic action. Probiotics in the fermentation system can reportedly proliferate rapidly, thereby inhibiting pathogenic bacteria and improving health [7]. Furthermore, these probiotics can produce small peptides, amino acids, oligosaccharides, immune factors, and other microbial secondary metabolites during the fermentation process [8,9]. Therefore, enzymatic action and fermentation reduce the bitterness of CHMs, improve their palatability, reduce their adverse effects, enhance their efficacy, and help in improving nutrient absorption from the feed [10].
Currently, studies on the enzymolysis fermentation of CHMs to improve the late-laying performance of hens and understand the underlying mechanism are lacking. Tian et al [11] reported that adding fermented Chinese herbs to the feed significantly increased production performance and egg quality of laying hens and reduced production costs. Moreover, most studies are based on the anaerobic fermentation of single or compound CHMs with no addition of synergistic exogenous enzymes. The mechanism underlying the effects of fermented CHMs remains unclear. However, the different CHM compounds show different efficacies, and combined fermentation by multiple bacterial species is more beneficial to the health of the organism than fermentation by a single bacterial species [12]. Therefore, in this experiment, according to the principles of incompatibility and compensation multiplication, we rationally formulated compound CHMs to improve reproductive function. We screened compound probiotics and high-cleavage compound enzymes, performed anaerobic fermentation, and established an efficient and synergistic enzymatic fermentation system. We studied the effects of cell wall degradation and release of CHM active components during enzymolysis fermentation on egg production performance, egg quality, lipid metabolism, serum reproductive hormone levels, and the mRNA expression of the follicle stimulating hormone receptor (FSHR), luteinizing hormone receptor (LHR), and estrogen receptor 2 (ESR2) in laying hens during the late-laying period.

MATERIALS AND METHODS

Experimental materials

The composition and content of crushed CHM, fermented CHM, and enzymatically fermented CHM are shown in Table 1. Compound CHMs, corn, wheat bran, soybean meal, and brown sugar were crushed and sieved through a 40-mesh screen. Compound CHMs comprised Astragalus, Chinese hawthorn, Wolfiporia extensa Ginns, Angelica sinensis, Leonurus japonicus, Alpinia oxyphylla, and dandelion, which were mixed in the ratio of 4:4:2:4:3:2:6. The raw CHM materials were purchased from Bozhou Hongzhe Pharmaceutical Co., Ltd. The enzyme activities of cellulase, xylanase, pectinase, and phytase were 1×104 U/g, 3×104 U/g, 3×104 U/g, and 4×104 U/g, respectively, and they were purchased from Xin Dayang Neiqiu Biology Science and Technology Co., Ltd. Lactobacillus plantarum, Saccharomyces cerevisiae, and Aspergillus niger live bacterial counts were 1×1010 CFU/g, 2×1010 CFU/g, and 2×1011 CFU/g, respectively. They were purchased from Jiangsu Youshi Biotechnology Development Co., Ltd.

Preparation of crushed Chinese herbal medicine, fermented Chinese herbal medicine, and enzymatically fermented Chinese herbal medicine

Crushed CHM was mixed according to the material ratio given in Table 1. Fermented CHM and enzymatically fermented CHM were prepared according to the material composition specified in Table 1. First, Lactobacillus plantarum, Saccharomyces cerevisiae, and Aspergillus niger were added to warm water (40°C) and left for 30 min for activation. Subsequently, the activated bacterial suspension was inoculated into the prepared substrates and mixed uniformly. The mixture was subjected to anaerobic fermentation at 37°C for 7 d in a fermentation bag with a one-way breather valve to prepare the fermented CHM and enzymatically fermented CHM. Six replicates were performed for crushed CHM, fermented CHM, and enzymatically fermented CHM.

Animals and experimental design

A total of 360 healthy 390-day-old Hy-Line Brown laying hens with initial laying rate of 84%±1% were randomly allocated to four groups of six replicates each, with 15 hens in each replicate, and reared in cages (5 hens per cage). The control (C) group was fed a basal diet. The crushed CHM (CT), fermented CHM (FC), and enzymatically fermented CHM (EFT) groups were fed an experimental group diet containing 2% crushed CHM, 2% fermented CHM, and 2% enzymatically fermented CHM, respectively. The diet formulations and nutrient levels are shown in Table 2. Before feeding, the prepared crushed CHM, fermented CHM, or enzymatically fermented CHM were premixed with soybean meal and then mixed with other raw materials in Table 2. The laying hens were given ad libitum access to feed and water during the experiment and fed twice a day at 07:00 and 15:00 for 8 weeks. The experimental protocol of this study was approved by the Animal Care Committee of the Anhui Science and Technology University (2020-05).

Cell wall fibers and intracellular active ingredients of Chinese herbal medicine

The levels of neutral detergent fiber (NDF), acid detergent fiber (ADF), total flavonoids, crude polysaccharides, and total saponins were measured crushed CHM, fermented CHM, and enzymatically fermented CHM. NDF and ADF were measured sequentially [13] using an Fiber Analyzer (ANKOM 220; ANKOM, Macedon, NY, USA). Total flavonoids, crude polysaccharides, and total saponins were determined using the NaNO2–Al(NO3)3–NaOH colorimetric method, phenol–sulfuric acid method, and vanillin–perchloric acid colorimetric method, respectively [14].

Egg production performance, egg quality, and sampling

The number of eggs and egg weight for each replicate was recorded daily, and the feed intake of each replicate was recorded weekly. The feed conversion ratio (FCR) was calculated as feed intake divided by the total egg weight. In each group, 30 eggs were randomly tested per week for egg quality using an egg analyzer (EA-01; Tenovo International Co., Ltd, Beijing, China) and an egg force reader (RH-DQ200; Guangzhou Runhu Instrument Co., Ltd, Guangzhou, China). At the end of the experiment, 12 hens were randomly selected from each group, and 10 mL of blood was collected from the wing vein after 12 h of fasting. The blood was centrifuged at 4°C and 3,000 rpm for 15 min. Serum was collected and stored at −20°C. Following blood collection and euthanasia, the ovaries were removed and stored at −80°C after liquid nitrogen snap-freezing.

Serum lipid metabolism

Total cholesterol (TC), triglyceride (TG), and alkaline phosphatase (ALP) levels in the serum were measured using an automatic biochemistry analyzer (ZY-350; Kehua Biotechnology Co., Ltd, Shanghai, China). The reagent kits were purchased from Shanghai Kehua Bio-Engineering Co. Ltd. (Shanghai, China).

Serum reproductive hormones

Serum levels of estrogen (E2), follicle stimulating hormone (FSH), and LH were measured using an automatic enzyme-linked immunosorbent assay system (Multiskan Go, Waltham, MA, USA). The reagent kits were procured from Beijing Daka Mei Technology Co., Ltd. (Beijing, China).

Ovarian hormone receptor mRNA expression

Ovarian hormone mRNA was extracted using the TRIzol method, and the RNA concentration was determined using a nucleic acid protein analyzer (Nanodrop One; Thermo, Waltham, MA, USA). RNA quality was assessed with 3% agarose gel electrophoresis and reverse transcribed to cDNA using a kit from Tiangen Biotechnology Co., Ltd. (Beijing, China). Primers were designed using the software Primer Premier 5 for the gene sequences of the FSHR, LHR, ESR2, and β-actin. The primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd. (Shanghai, China). The primer information is provided in Table 3. FSHR, LHR, and ESR2 were quantitatively analyzed with SYBR Green quantitative real-time polymerase chain reaction (ABI-7300; ABI, Carlsbad, CA, USA), and the kits were obtained from Tiangen Biotechnology Co., Ltd. (Beijing, China). Relative gene expression was calculated using the 2−ΔΔCt method, with β-actin serving as the reference gene.

Statistical analysis

SPSS software (version 21.0; IBM Inc., San Francisco, CA, USA) was used for one-way analysis of variance followed by Duncan’s multiple comparison tests of the experimental data. The results were expressed as means. A difference of p<0.05 was considered to be significant.

RESULTS

Changes in fiber and active ingredient content Chinese herbal medicine

Changes in fiber and active ingredient concentrations in different treatment methods of CHM are shown in Table 4. NDF levels were lower (p = 0.003) and the total flavonoids and total saponin were higher (p<0.001) in the enzymatically fermented CHM than in the crushed CHM and fermented CHM. The enzymatically fermented CHM and fermented CHM had lower ADF levels than crushed CHM (p = 0.022). NDF levels were lower (p = 0.003) and the total saponin levels were higher (p<0.001) in the enzymatically fermented CHM than in the fermented CHM.

Egg production performance

The effects of different treatment methods of CHM on egg production performance of laying hens in the late-laying period are shown in Table 5. During the 1 to 8 weeks of the experiment, the laying rate was higher and the FCR was lower in the FC and EFT groups than in the C and CT groups (p< 0.05). During the 5 to 8 weeks of the experiment, the CT, FC, and EFT groups had higher feed intake than C group (p<0.001). The EFT group had higher laying rate than the FC group (p<0.001). The EFT group had a lower FCR than CT group (p<0.001).

Egg quality

The effects of different treatment methods of CHM on egg quality of laying hens in the late-laying period are shown in Table 6. During the 1 to 4 weeks of the experiment, the ETF group had a thicker of eggshell than the C group (p<0.034). During the 5 to 8 weeks of the experiment, the haugh unit (p = 0.009) and albumin height (p<0.001) were higher in the FC and EFT groups than in the C and CT groups. The yolk color was more intense in the CT, FC, and EFT groups than in the C group (p = 0.006). The eggshell thickness (p<0.001) and shell strength (p = 0.012) were greater in the FC and EFT groups than in the C group. The ETF group had greater albumin height and eggshell thickness than the C group (p<0.001).

Serum lipid metabolism and serum reproductive hormones

As shown in Table 7, the serum TC levels were lower in the FC and EFT groups than in the C and CT groups (p<0.001). The ETF group had lower serum TC levels than the FC group (p<0.001). Furthermore, serum TG and ALP levels showed no significant intergroup differences. As shown in Table 8, serum E2 and FSH levels were not significantly different among all groups. The ETF group had higher serum LH levels than the C, CT, and FC groups (p<0.001).

Ovarian hormone receptor mRNA expression

As presented in Table 9, the mRNA expression levels of FSHR, LHR, and ESR2 were higher in the FC and EFT groups than in the C and CT groups (p<0.001). The CT group had higher mRNA expression of FSHR and LHR than the C group (p< 0.001). The ETF group had higher mRNA expression of FSHR and LHR than the FC group (p<0.001).

DISCUSSION

Different types of CHMs and their combinations have different effects. The seven CHMs selected in this experiment, namely, Astragalus, Chinese hawthorn, Wolfiporia extensa Ginns, Angelica sinensis, Leonurus japonicus, Alpinia oxyphylla, and dandelion, can strengthen the spleen, dispel dampness, activate blood, exert an antiinflammatory effect, and enhance immunity. Most of the active ingredients in the CHM are protected by hard cell walls that cannot be easily degraded, affecting the release and efficacy of the ingredients. In this experiment, the contents of NDF and ADF in enzymatically fermented CHM were significantly decreased by 10.39% and 12.70%, respectively, compared with crushed CHM. The contents of NDF in enzymatically fermented CHM were significantly decreased by 17.54%, compared with fermented CHM. The contents of ADF in fermented CHM were significantly decreased by 8.99%, compared with crushed CHM. The results showed that the fiber could be degraded by enzymolysis fermentation or fermentation. However, after enzymolysis fermentation, CHM released more cell contents and cell wall lysed more thoroughly. These observations were verified by another result of this experiment, which found that the total flavonoid and saponin contents of the enzymatically fermented CHM were significantly increased by 50.00% and 42.62%, respectively, compared with the crushed CHM. The total flavonoid and saponin contents of the fermented CHM were significantly increased by 50.00% and 14.75%, respectively, compared with the crushed CHM. This may be because the probiotics added in the fermentation CHM can metabolize enzymes, but the activity of enzymes is low and the types are not comprehensive enough, which leads to insufficient fermentation. Cellulase, xylanase, pectinase, and phytase added to the enzymatically fermented CHM system can dissolve the cell wall components more thoroughly [15]. Liu et al [16] used Candida utilis, Lactobacillus casei, and Enterococcus faecalis to ferment Saponaria vaccaria and Leonurus japonicus. After fermentation, total flavonoids, total alkaloids, crude polysaccharides, and total saponins increased significantly by 55.14%, 127.28%, 55.42%, and 49.21%, respectively, compared to before fermentation. This result is consistent with the increase in total flavonoids and saponins observed in fermented CHM in this study. Furthermore, the content of crude polysaccharide in this experiment was not significantly improved. It was speculated that the crude polysaccharide contents of different CHMs differed. Another possibility is that the probiotics in the fermentation or enzymolysis fermentation system used a small amount of polysaccharides as substrates, which requires further in-depth studies.
In this study, the crushed CHM did not improve the laying performance and egg quality of the hens. It is hypothesized that the active ingredients of CHM sifted through the 40-mesh sieve after physical pulverization could not be fully released, thus affecting the efficacy of CHM. During the 5 to 8 weeks of this study, the FC and EFT groups showed significant improvements of 5.38% and 8.80%, 10.62% and 12.09%, 2.74% and 4.81%, 2.08% and 2.88%, 3.26% and 4.71%, 3.92% and 7.28%, 5.13% and 7.53% in the laying rate, FCR, haugh unit, albumin height, yolk color, shell thickness, shell strength, respectively, compared with the C group. The CHM enzymatically fermented using compound enzyme and probiotics had a more positive effect on egg production performance and egg quality compared to the crushed CHM and fermented CHM. This can be attributed to the release of more active ingredients, including total flavones and total saponins, by exogenous enzymes acting on the cell wall of CHM during enzymatic fermentation. These active ingredients can interact with probiotics to produce novel active compounds, which can improve the pharmacological properties of CHM [17]. Zhao et al [12] fermented ginkgo leaves with yeast and found no significant effect on the laying rate of hens, whereas fermented ginkgo leaves with Aspergillus niger and multiple strains significantly increased the laying rates of hens by 4.66% and 4.07%, respectively, compared with that in the control group. This finding implies that the effect of CHM fermentation on the egg production performance of laying hens is related to the fermentation strain. In this experiment, three strains were selected, of which Aspergillus niger and Saccharomyces cerevisiae consumed the oxygen in the fermentation substrate, creating an anaerobic environment to facilitate the anaerobic fermentation of Lactobacillus plantarum and resulting in a more complete fermentation. Furthermore, the FC and EFT groups had a higher laying rate, which could be because the fermentation or enzymolysis fermentation effect of compound CHMs is better than that of single CHM [18]. Although a single CHM has good efficacy, a compound CHMs acting on different pharmacological targets will produce a synergistic effect that is 50 times greater than that of a single CHM at the same concentration [19].
Prolongation of the production cycle in laying hens leads to gradual aging of the body tissues and decrease in the levels of metabolizable lipids, which affecting egg production performance. In this experiment, serum TC levels in the EFT group were significantly reduced by 30.80%, 30.53%, and 14.15% compared with those in the C, CT, and FC groups, respectively. This could be because dandelion contains total flavonoids such as luteolin 22, which accelerates lipid metabolism [20]. Total flavonoids in Chinese hawthorn can also improve liver lipid metabolism [21]. Furthermore, the structural changes of total flavonoids mediated by compound enzyme and probiotic enzymolysis fermentation accelerated the absorption rate and amount of the active ingredients, which may improve the bioactivity and bioavailability of the active ingredients [22,23]. The substrate after enzymolysis can be better utilized by thallus and form a positive promoting effect. However, enzymolysis fermentation of CHM did not significantly reduce serum TG levels, warranting further studies. Serum TC levels were also significantly lower in the FC group than in the C and CT groups. These results indicated that fermentation CHM could also play a role in regulating lipid metabolism; however, the effect was not as good as that of enzymolysis fermentation CHM. This could be because probiotics in the fermentation CHM not only proliferated in large numbers and effectively regulated the balance of intestinal microflora but also produced organic acids and endogenous enzymes capable of inhibiting and killing pathogenic bacteria, promoting the absorption and utilization of nutrients such as lipids [24], facilitating nutrient metabolism, and reducing lipid deposition.
Reproductive hormones in laying hens interact with the hypothalamic–pituitary–gonadal axis and regulate the entire reproductive activity, thus affecting their egg production performance and egg quality [25]. In the CHMs formula of this experiment, Leonurus japonicas is rich in leonurine, which can promote the secretion of LH and FSH by the pituitary gland [26]. Wolfiporia extensa Ginns is rich in Fuling polysaccharide, which can improve the health and regulate the balance of sex hormones [27]. Ferulic acid in Angelica sinensis and total flavonoids in Astragalus can restore ovarian function [28]. The above-mentioned CHMs can reduce toxicity and enhance efficacy after enzymolysis fermentation [17]. The serum LH level of laying hens in the EFT group significantly increased by 16.87% compared with that in the C group, but there was no significant increase in the CT and FC groups. This result indicates that enzymolysis fermentation of CHM regulate the reproductive performance of laying hens better than crushed CHM and fermented CHM. This was also confirmed by the results of the laying rate in the above groups in this experiment. Xiao et al [29] showed that when laying hens were given a combination of Astragalus, Salvia miltiorrhiza, and Cnidium monnieri, their serum LH levels increased significantly by 41.63% compared with the control group. The serum LH level in the above study increased more than that in the present study, which may be related to the different formula of CHMs and needs further research. Increased LH levels facilitate the regulation of follicular growth and maturation. Nonetheless, FSH and LH cannot directly penetrate the cell membrane and require the mediation of ovary-specific receptors [30]. Therefore, increased expressions of FSHR and LHR play an important role in reproductive performance. ESR2 acts as a signal transduction factor in the cytoplasm of oocytes to promote their development and maintain ovarian function by regulating steroid hormones [31]. In this experiment, the expressions of FSHR, LHR, and ESR2 mRNA in the ovaries of laying hens in the FC and EFT groups were significantly increased compared with those in the C and CT groups. However, EFT group had better effect. This also demonstrates the triple synergistic effects of cell wall degradation, probiotic fermentation, and the inherent potency of CHM in enzymolysis fermentation. Therefore, the enzymolysis fermentation of CHM have a good delaying effect on the decline in egg production performance and egg quality caused by the prolonged production cycle in late-laying hens. This may be related to the increased expression of serum levels of LH and mRNA expression of FSHR, LHR, and ESR2.

CONCLUSION

The outcomes of the present study have demonstrated that the CHMs treated with enzymolysis fermentation delay the decline in egg production performance and egg quality and enhance lipid metabolism in the late-laying stage of hens. The mechanisms may be associated with cell wall degradation of CHM by exogenous compound enzymes, increased intracellular release of active components, and an increase in serum LH levels and mRNA expressions of FSHR, LHR, and ESR2.

Notes

CONFLICT OF INTEREST

We certify that there is no conflict of interest with any financial organization regarding the material discussed in the manuscript. Wang QM is an employee of Shandong Jinghua Agriculture and Animal Husbandry Development Co., Ltd., and Jin Shan Ge JS is an employee of Shandong Zhongcheng Feed Technology Co., Ltd..

FUNDING

The authors received no financial support for this article.

ACKNOWLEDGMENTS

The authors thank the teachers of the Anhui Science and Technology University who helped in this research.

Table 1
Composition and content of crushed Chinese herbal medicine, fermented Chinese herbal medicine, and enzymatically fermented Chinese herbal medicine
Raw material Crushed CHM Fermented CHM Enzymatically fermented CHM
Compound CHM 18.18 18.18 18.18
Aspergillus niger 0.00 0.13 0.13
Saccharomyces cerevisiae 0.00 0.04 0.04
Lactobacillus plantarum 0.00 0.13 0.13
Pectinase 0.00 0.00 0.10
Cellulase 0.00 0.00 0.03
Xylanase 0.00 0.00 0.07
Phytase 0.00 0.00 0.10
Corn 20.36 20.36 20.36
Wheat bran 12.73 12.73 12.73
Soybean meal 8.48 8.48 8.48
Brown sugar 0.85 0.85 0.85
Water 39.40 39.10 38.80
Total 100.00 100.00 100.00

CHM, Chinese herbal medicine.

Table 2
Feed formulation and nutrient levels (based on air-dried feed)
Item C CT FC EFT
Corn 62.50 61.00 61.00 61.00
Soybean meal 24.50 24.00 24.00 24.00
Calcium carbonate 8.00 8.00 8.00 8.00
Premixed feed1) 5.00 5.00 5.00 5.00
Crushed CHM 0.00 2.00 0.00 0.00
Fermented CHM 0.00 0.00 2.00 0.00
Enzymatically fermented CHM 0.00 0.00 0.00 2.00
Total 100.00 100.00 100.00 100.00
Nutrient level
 Crude protein 15.78 15.62 15.61 15.61
 Calcium 3.81 3.81 3.81 3.81
 Total phosphorus 0.45 0.45 0.45 0.45
 Sodium chloride 0.33 0.33 0.33 0.33
 Crude ash 13.73 13.72 13.72 13.72
 Crude fiber 2.34 2.38 2.38 2.38
 Metabolizable energy (MJ/kg) 10.88 10.75 10.75 10.75
 Lysine 0.79 0.79 0.79 0.79
 Methionine 0.38 0.38 0.38 0.38
 Isoleucine 0.59 0.58 0.58 0.58
 Threonine 0.65 0.64 0.64 0.64
 Tryptophan 0.20 0.20 0.20 0.20
 Valine 0.72 0.71 0.71 0.71
 Dry matter 88.47 87.82 87.82 87.82

C, control group; CT, crushed Chinese herbal medicine group; FC, fermented Chinese herbal medicine group; EFT, enzymatically fermented Chinese herbal medicine group; CHM, Chinese herbal medicine.

1) The premixed feed consists of the following: Vitamin A 10,000 IU, Vitamin E 25 mg, Vitamin D3 2,500 IU, Vitamin K3 1.0 mg, Vitamin B1 2.5 mg, Vitamin B2 5.5 mg, Vitamin B6 4.0 mg, Vitamin B12 0.008 mg, niacin 31 mg, pantothenic acid 16 mg, biotin 0.3 mg, choline 500 mg, folic acid 1.8 mg, Fe 90 mg, Cu 12.5 mg, Zn 80 mg, Se 0.2 mg, Mn 80 mg, and I 0.45 mg per kg of feed.

Table 3
Primer information
Gene Accession No. Primer sequence (5′–3′) Product size (bp)
FSHR NM_205079.2 F: ACCTGCCTGGATGAGCTAAAT
R: ATCCAAAACAACAGGCCCGA
96
LHR XM_038176401.1 F:ACTTGAGGACAGAGAACTACAGAG
R: TTTCTTCATCTGCTGCAAGCG
93
ESR2 NM_001396358.1 F: CCTTGTACTCGACAGGGACG
R: CTGCAGTTTCAGCTCTCGGA
103
β-actin NM_001310421.1 F: GATGGCTCCGGTATGTGCAA
R: CAACCATCACACCCTGATGTC
103

FSHR, follicle stimulating hormone receptor; LHR, luteinizing hormone receptor; ESR2, estrogen receptor.

Table 4
Changes in fiber and active compound content Chinese herbal medicine
Item Crushed CHM fermented CHM Enzymatically fermented CHM SEM p-value
NDF (%) 27.90a 27.04a 25.00b 0.467 0.003
ADF (%) 10.79a 9.82b 9.42b 0.240 0.022
Total flavonoids (mg/g) 0.06a 0.09b 0.09b 0.004 <0.001
Crude polysaccharide (%) 9.22 8.24 8.99 0.186 0.050
Total saponin (mg/g) 0.61a 0.70b 0.87c 0.039 <0.001

CHM, Chinese herbal medicine; SEM, standard error of the means; NDF, neutral detergent fiber; ADF, acid detergent fiber.

a–c Values within a row with different superscripts differ significantly at p<0.05.

Table 5
Effect of enzymolysis fermentation of Chinese herbal medicine on egg production performance in laying hens
Items C CT FC EFT SEM p-value
Laying rate (%)
 1 to 4 wk 78.22a 77.23a 81.34b 82.59b 0.640 <0.001
 5 to 8 wk 76.17a 75.79a 80.27b 82.87c 0.800 <0.001
Egg weight (g)
 1 to 4 wk 62.93 62.78 63.41 63.96 0.176 0.056
 5 to 8 wk 63.12 63.03 63.32 64.16 0.227 0.293
Feed intake (g)
 1 to 4 wk 122.20 123.40 124.87 125.36 1.013 0.725
 5 to 8 wk 126.93a 129.94b 131.34bc 132.87c 0.663 <0.001
FCR
 1 to 4 wk 2.55a 2.55a 2.38b 2.36b 0.031 0.013
 5 to 8 wk 2.73a 2.71a 2.44b 2.40b 0.039 <0.001

C, control group; CT, crushed Chinese herbal medicine group; FC, fermented Chinese herbal medicine group; EFT, enzymatically fermented Chinese herbal medicine group; SEM, standard error of the means; FCR, feed conversion ratio.

a–c Values within a row with different superscripts differ significantly at p<0.05.

Table 6
Effect of enzymolysis fermentation of Chinese herbal medicine on egg quality in laying hens
Items C CT FC EFT SEM p-value
Haugh unit
 1 to 4 wk 74.45 74.49 74.15 74.51 0.172 0.893
 5 to 8 weeks 73.35a 74.91ab 75.36bc 76.88c 0.416 0.009
Albumin height (mm)
 1 to 4 wk 6.32 6.34 6.34 6.35 0.007 0.425
 5 to 8 wk 6.24a 6.29a 6.37b 6.42c 0.019 <0.001
Yolk color
 1 to 4 wk 5.68 5.67 5.67 5.74 0.012 0.135
 5 to 8 wk 5.52a 5.68b 5.70b 5.78b 0.030 0.006
Shell thickness (mm)
 1 to 4 wk 0.373a 0.376ab 0.379ab 0.382b 0.001 0.034
 5 to 8 wk 0.357a 0.364ab 0.371b 0.383c 0.002 <0.001
Shell strength (N)
 1 to 4 wk 39.49 39.16 38.99 38.84 0.148 0.493
 5 to 8 wk 37.44a 38.98ab 39.36b 40.49b 0.369 0.012
Egg shape index
 1 to 4 wk 1.31 1.32 1.30 1.31 0.002 0.150
 5 to 8 wk 1.31 1.31 1.31 1.31 0.002 0.243

C, control group; CT, crushed Chinese herbal medicine group; FC, fermented Chinese herbal medicine group; EFT, enzymatically fermented Chinese herbal medicine group; SEM, standard error of the means.

a–c Values within a row with different superscripts differ significantly at p<0.05.

Table 7
Effect of enzymolysis fermentation of Chinese herbal medicine on serum lipid metabolism in laying hens
Item C CT FC EFT SEM p-value
TC (mmol/L) 2.63a 2.62a 2.12b 1.82c 0.106 <0.001
TG (mmol/L) 9.70 9.76 9.70 9.73 0.128 0.999
ALP (U/L) 241.33 247.00 235.00 233.33 2.156 0.066

C, control group; CT, crushed Chinese herbal medicine group; FC, fermented Chinese herbal medicine group; EFT, enzymatically fermented Chinese herbal medicine group; SEM, standard error of the means; TC, total cholesterol; TG, triglyceride; ALP, alkaline phosphatase.

a–c Values within a row with different superscripts differ significantly at p<0.05.

Table 8
Effect of enzymolysis fermentation of Chinese herbal medicine on serum hormones in laying hens
Item C CT FC EFT SEM p-value
E2 (pg/mL) 335.45 338.08 335.08 335.18 2.807 0.980
LH (mIU/mL) 9.13a 9.27a 9.70a 10.67b 0.153 <0.001
FSH (mIU/mL) 12.54 12.55 12.51 12.63 0.119 0.990

C, control group; CT, crushed Chinese herbal medicine group; FC, fermented Chinese herbal medicine group; EFT, enzymatically fermented Chinese herbal medicine group; SEM, standard error of the means; E2, estrogen; LH, luteinizing hormone; FSH, follicle stimulating hormone.

a,b Values within a row with different superscripts differ significantly at p<0.05.

Table 9
Effect of enzymolysis fermentation of Chinese herbal medicine on the mRNA expression of ovarian hormone receptors in laying hens
Item C CT FC EFT SEM p-value
FSHR 1.00a 1.39b 1.60c 1.98d 0.054 <0.001
LHR 1.00a 1.46b 1.97c 2.68d 0.092 <0.001
ESR2 1.00a 0.99a 1.43b 1.49b 0.036 <0.001

C, control group; CT, crushed Chinese herbal medicine group; FC, fermented Chinese herbal medicine group; EFT, enzymatically fermented Chinese herbal medicine group; SEM, standard error of the means; FSHR, follicle stimulating hormone receptor; LHR, luteinizing hormone receptor; ESR2, estrogen receptor 2.

a–d Values within a row with different superscripts differ significantly at p<0.05.

REFERENCES

1. Rozenboim I, Mahato J, Cohen NA, Tirosh O. Low protein and high-energy diet: A possible natural cause of fatty liver hemorrhagic syndrome in caged white leghorn laying hens. Poult Sci 2016;95:612–21. https://doi.org/10.3382/ps/pev367
crossref pmid
2. Long L, Wu SG, Yuan F, Zhang HJ, Wang J, Qi GH. Effects of dietary octacosanol supplementation on laying performance, egg quality, serum hormone levels, and expression of genes related to the reproductive axis in laying hens. Poult Sci 2017;96:894–903. https://doi.org/10.3382/ps/pew316
crossref pmid
3. Pu H, Li X, Du Q, Cui H, Xu Y. Research progress in the application of Chinese herbal medicines in aquaculture: a review. Engineering 2017;3:731–7. https://doi.org/10.1016/J.ENG.2017.03.017
crossref
4. Zhou X, Seto SW, Chang D, et al. Synergistic effects of Chinese herbal medicine: a comprehensive review of methodology and current research. Front Pharmacol 2016;7:201. https://doi.org/10.3389/fphar.2016.00201
crossref pmid pmc
5. Wang Y, Li J, Xie Y, et al. Effects of a probiotic-fermented herbal blend on the growth performance, intestinal flora and immune function of chicks infected with Salmonella pullorum. Poult Sci 2021;100:101196. https://doi.org/10.1016/j.psj.2021.101196
crossref pmid pmc
6. Houfani AA, Anders N, Spiess AC, Baldrian P, Benallaoua S. Insights from enzymatic degradation of cellulose and hemicellulose to fermentable sugars–A review. Biomass Bioenergy 2020;134:105481. https://doi.org/10.1016/j.biombioe.2020.105481
crossref
7. Li L, Wang L, Fan W, et al. The application of fermentation technology in traditional Chinese medicine: a review. Am J Chin Med 2020;48:899–921. https://doi.org/10.1142/S0192415X20500433
crossref pmid
8. Wu T, Wang N, Zhang Y, Xu X. Advances in the study on microbial fermentation and transformation of traditional Chinese medicine. Afr J Microbiol Res 2013;7:1644–50. https://doi.org/10.5897/AJMRx12.012
crossref
9. Jin W, Zhang Z, Zhu K, Xue Y, Xie F, Mao S. Comprehensive Understanding of the Bacterial Populations and Metabolites Profile of Fermented Feed by 16S rRNA Gene Sequencing and Liquid Chromatography–Mass Spectrometry. Metabolites 2019;9:239. https://doi.org/10.3390/metabo9100239
crossref pmid pmc
10. Yang FC, Yang YH, Lu HC. Enhanced antioxidant and antitumor activities of Antrodia cinnamomea cultured with cereal substrates in solid state fermentation. Biochem Eng J 2013;78:108–13. https://doi.org/10.1016/j.bej.2013.04.020
crossref
11. Tian Y, Li G, Zhang S, et al. Dietary supplementation with fermented plant product modulates production performance, egg quality, intestinal mucosal barrier, and cecal microbiota in laying hens. Front Microbiol 2022;13:955115. https://doi.org/10.3389/fmicb.2022.955115
crossref pmid pmc
12. Zhao L, Zhang X, Cao F, Sun D, Wang T, Wang G. Effect of dietary supplementation with fermented Ginkgo-leaves on performance, egg quality, lipid metabolism and egg-yolk fatty acids composition in laying hens. Livest Sci 2013;155:77–85. https://doi.org/10.1016/j.livsci.2013.03.024
crossref
13. Wolters MGE, Verbeek C, Van Westerop JJM, Hermus RJ, Voragen AG. Comparison of different methods for determination of dietary fiber. J AOAC Int 1992;75:626–34. https://doi.org/10.1093/jaoac/75.4.626
crossref
14. Li XC, Lin J, Han WJ, et al. Antioxidant ability and mechanism of rhizoma Atractylodes macrocephala. Molecules 2012;17:13457–72. https://doi.org/10.3390/molecules171113457
crossref pmid pmc
15. De Souza TSP, Kawaguti HY. Cellulases, hemicellulases, and pectinases: Applications in the food and beverage industry. Food Bioproc Tech 2021;14:1446–77. https://doi.org/10.1007/s11947-021-02678-z
crossref
16. Liu Y, Jin SY, Chang J, et al. Changes of active ingredients before and after compound probiotic fermented Chinese herbs. J Anhui Agric Sci 2017;45:123–5. https://doi.org/10.13989/j.cnki.0517-6611.2017.34.039
crossref
17. Hussain A, Bose S, Wang JH, Yadav MK, Mahajan GB, Kim H. Fermentation, a feasible strategy for enhancing bioactivity of herbal medicines. Food Res Int 2016;81:1–16. https://doi.org/10.1016/j.foodres.2015.12.026
crossref
18. Shan CH, Guo JJ, Sun XS, et al. Effects of fermented Chinese herbal medicines on milk performance and immune function in late-lactation cows under heat stress conditions. J Anim Sci 2018;96:4444–57. https://doi.org/10.1093/jas/sky270
crossref pmid pmc
19. Burns JJ, Zhao L, Taylor EW, Spelman K. The influence of traditional herbal formulas on cytokine activity. Toxicol 2010;278:140–59. https://doi.org/10.1016/j.tox.2009.09.020
crossref
20. González-Castejón M, Visioli F, Rodriguez-Casado A. Diverse biological activities of dandelion. Nutr Rev 2012;70:534–47. https://doi.org/10.1111/j.1753-4887.2012.00509.x
crossref pmid
21. Dai HJ, Lv ZP, Huang ZW, et al. Dietary hawthorn-leaves flavonoids improves ovarian function and liver lipid metabolism in aged breeder hens. Poult Sci 2021;100:101499. https://doi.org/10.1016/j.psj.2021.101499
crossref pmid pmc
22. Izumi T, Piskula MK, Osawa S, et al. Soy isoflavone aglycones are absorbed faster and in higher amounts than their glucosides in humans. J Nutr 2000;130:1695–9. https://doi.org/10.1093/jn/130.7.1695
crossref pmid
23. Hendrich S. Bioavailability of isoflavones. J Chromatogr B 2002;777:203–10. https://doi.org/10.1016/S1570-0232(02)00347-1
crossref
24. Qiao H, Zhang X, Shi H, Song Y, Bian C, Guo A. Assessment of the physicochemical properties and bacterial composition of Lactobacillus plantarum and Enterococcus faecium-fermented Astragalus membranaceus using single molecule, real-time sequencing technology. Sci Rep 2018;8:11862. https://doi.org/10.1038/s41598-018-30288-x
crossref pmid pmc
25. Wang F, Zou P, Xu SJ, et al. Dietary supplementation of Macleaya cordata extract and Bacillus in combination improve laying performance by regulating reproductive hormones, intestinal microbiota and barrier function of laying hens. J Anim Sci Biotechnol 2022;13:118. https://doi.org/10.1186/s40104-022-00766-4
crossref pmid pmc
26. Li X, Yuan FL, Zhao YQ, et al. Effects of leonurine hydrochloride on medically induced incomplete abortion in early pregnancy rats. Eur J Obstet Gynecol Reprod Biol 2011;159:375–80. https://doi.org/10.1016/j.ejogrb.2011.09.006
crossref pmid
27. Liu J, Yu J, Peng X. Poria cocos polysaccharides alleviates chronic nonbacterial prostatitis by preventing oxidative stress, regulating hormone production, modifying gut microbiota, and remodeling the DNA methylome. J Agric Food Chem 2020;68:12661–70. https://doi.org/10.1021/acs.jafc.0c05943
crossref pmid
28. Wang L, Liu J, Nie G, Li Y, Yang H. Danggui Buxue tang rescues folliculogenesis and ovarian cell apoptosis in rats with premature ovarian insufficiency. Evid Based Complement Alternat Med 2021;2021:6614302. https://doi.org/10.1155/2021/6614302
crossref pmid pmc
29. Xiao YQ, Shao D, Sheng ZW, Wang Q, Shi SR. A mixture of daidzein and Chinese herbs increases egg production and eggshell strength as well as blood plasma Ca, P, antioxidative enzymes, and luteinizing hormone levels in post-peak, brown laying hens. Poult Sci 2019;98:3298–3303. https://doi.org/10.3382/ps/pez178
crossref pmid
30. Nikolettos N, Asimakopoulos B, Papastefanou IS. Intracytoplasmic sperm injection-an assisted reproduction technique that should make us cautious about imprinting deregulation. J Soc Gynecol Investig 2006;13:317–28. https://doi.org/10.1016/j.jsgi.2006.04.002
crossref pmid
31. Razandi M, Pedram A, Greene GL, Levin ER. Cell membrane and nuclear estrogen receptors (ERs) originate from a single transcript: Studies of ERα and ERβ expressed in Chinese hamster ovary cells. Mol Endocrinol 1999;13:307–19. https://doi.org/10.1210/mend.13.2.0239
crossref pmid


Editorial Office
Asian-Australasian Association of Animal Production Societies(AAAP)
Room 708 Sammo Sporex, 23, Sillim-ro 59-gil, Gwanak-gu, Seoul 08776, Korea   
TEL : +82-2-888-6558    FAX : +82-2-888-6559   
E-mail : editor@animbiosci.org               

Copyright © 2026 by Asian-Australasian Association of Animal Production Societies.

Developed in M2PI

Close layer
prev next