Go to Top Go to Bottom
Anim Biosci > Volume 38(4); 2025 > Article
Zhang, Chang, Xue, Wang, Liu, Wei, and Li: Intermittent cold stimulation acclimates broilers to acute cold stress by affecting cardiac lipid metabolism

Abstract

Objective

This study aimed to investigate whether intermittent cold stimulation can induce adaptation in broilers to acute cold stress (ACS) by regulating the lipid metabolism of hearts.

Methods

CS0 were kept at normal rearing temperature, while CS3 and CS5 were exposed to 3°C for 3 and 5 hours, respectively, on alternate days lower than CS0 from 15d to 35d. On 50d, broilers in three groups were exposed to ACS at 10°C for 12 hours (Y12). The levels of corticosterone (CORT) and liothyronine (T3), mRNA and protein levels of heart adenosine monophosphate (AMP)-activated protein kinase/mammalian target of rapamycin (AMPK/mTOR) pathway genes were assessed at 36 d, 50 d and Y12.

Results

At 36d, mRNA levels of AMPKα, acyl-CoA oxidase (ACO), mTOR, sterol-regulatory element binding protein (SREBP), stearoyl-coA desaturase (SCD), acetyl-coA carboxylase (ACC), fatty acid synthase (FAS) and protein level of peroxisome proliferators-activated receptor α (PPARα) in CS3 and CS5 were significantly lower than those in CS0 (p<0.05). At 50d, compared to CS0, mRNA levels of PPARα, carnitine palmitoyltransferase1 (CPT1), ACO, tuberous sclerosis complex (TSC), SREBP and SCD, as well as protein levels of p-AMPKα/AMPKα, PPARα and SREBP were significantly increased in CS5 (p<0.05). At Y12, the levels of T3 in CS3 and CS5 were significantly higher than those in CS0 (p<0.05), mRNA levels of CPT1, ACO, SREBP, SCD and protein levels of p-AMPKα/AMPKα, SREBP, and FAS were significantly higher in CS5 than in CS0 and CS3 (p<0.05). However, compared to 50d, at Y12, mRNA levels of AMPKα, CPT1 and ACO in CS3 and CS5 significantly decreased (p<0.05), while protein levels of p-AMPKα/AMPKα significantly increased (p<0.05).

Conclusion

This study suggested that intermittent cold stimulation at 3°C lower than normal rearing temperature for 5h could help broilers adapt to the ACS by promoting heart lipid metabolism.

INTRODUCTION

Rapidly growing broilers are susceptible to various environmental stressors, including cold stress, which is one of the limiting factors for broiler production in northern China. Previous studies have indicated that the increase in cardiovascular disease mortality is positively correlated with a decrease in environmental temperature [1]. Cold stress can also lead to heart hypertrophy, interstitial fibrosis and reduced heart ejection fraction [2]. It is worth noting that exposure to cold stress cause neuroendocrine disruption and increased heat production, accompanied by the generation of heart oxidative stress [3]. Additionally, cold stress has been reported to impair heart energy status by reducing heart energy reserves and fatty acid oxidation capacity in broilers [4].
The ability of broilers to respond to cold stress depends on the appropriate involvement of the central and peripheral nervous systems, coordinating hormonal and immune regulation among multiple organ systems to establish homeostasis [5]. The hypothalamic-pituitary-adrenal (HPA) axis and hypothalamic-pituitary-thyroid (HPT) axis are integral components of the neuroendocrine system, secreting hormones such as corticosterone (CORT) and liothyronine (T3) to regulate responses to cold stress, including energy balance, thermoregulation and cold-induced thermogenesis [6]. CORT serves as the primary effector hormone of the HPA axis, reflecting the level of HPA axis activation under cold stress and influencing nearly all physiological systems, thereby redistributing energy or nutrient resources within biological systems. For instance, previous research has shown that cold stress significantly increases CORT levels in the blood of piglets and mice, accompanied by elevated levels of glucose and lipid substances, aiding in their adaptation to cold stress [7]. Cold stress also activates the HPT axis, subsequently leading to elevated levels of T3 and thyroxine (T4) in the blood [8]. Xie's study [9] found that cold stress accelerates the conversion of T4 to T3 in laying hens, thereby increasing blood T3 level to enhance catabolic metabolism, increase heat production, and promote the synthesis of intracellular proteins, RNA and DNA, thereby resisting cold stress damage. Therefore, investigating the changes in neuroendocrine hormones in broilers under cold stress is of significant importance for studying their physiological responses to cold stress and metabolic changes.
The adenosine monophosphate (AMP)-activated protein kinase/mammalian target of rapamycin (AMPK/mTOR) pathway is essential for restoring internal balance following stress stimulation. It is generally believed that when there is a relative increase in intracellular AMP or adenosine diphosphate (ADP) levels, the AMPK pathway stimulates downstream genes, such as peroxisome proliferators-activated receptor α (PPARα), carnitine palmitoyltransferase1 (CPT1) and acyl-CoA oxidase (ACO), thereby inhibiting synthetic metabolic pathways and promoting catabolic pathways to replenish adenosine triphosphate (ATP) supply in broilers [10]. Zhou et al found that cold stress induces enhanced expression of the AMPK gene in the intestines of broilers and upregulates the expression of intestinal tight junction genes, demonstrating a potential link between cold stress, AMPK and intestinal barrier function [11]. Study also has found that the expression levels of AMPKα, PPARα and CPT1 in broiler muscle were increased under nutrient deficiency conditions, which was thought to be related to the increased level of fatty acid oxidation [12]. As important downstream genes and regulatory nodes of the AMPK pathway, mTOR and its target genes exert effects that are precisely opposite to those of the AMPK pathway. Li et al [4] reported that in mice fed high glucose, the liver AMPK pathway was inhibited, while sterol-regulatory element binding protein (SREBP) and its downstream stearoyl-coA desaturase (SCD) and acetyl-coA carboxylase (ACC) were activated, resulting in non-alcoholic fatty liver in the mice. RNA sequencing results on chicken DF-1 cells revealed downregulation of genes including oxidative phosphorylation, ribosomes and mTOR after low-temperature stimulation. These genes primarily impact ribosomal translation and mitochondrial electron transport in DF-1 cells [13]. Although the role of the AMPK/mTOR pathway in skeletal muscle and liver has been well studied, its role in other metabolically active organs (such as the heart) remains largely unknown.
The detrimental effects of cold stress on heart function have been widely acknowledged, but research on how to alleviate cold-induced heart injury is relatively scarce. However, our previous studies have demonstrated that appropriate intermittent cold stimulation can significantly improve broiler performance and immune function, effectively mitigating acute cold stress (ACS) injury [1416]. Therefore, we hypothesized that appropriate intermittent cold stimulation could regulate the AMPK/mTOR pathway by affecting neuroendocrine hormone secretion, thereby regulating heart lipid metabolism and enhancing cold adaptability of broilers.

MATERIALS AND METHODS

Animals and experimental design

All experimental procedures performed in this study were approved by the Animal Care and Use Committee of Northeast Agricultural University (IACUCNEAU20150616).
A total of 240 healthy 1 d Ross 308 broilers were housed in three artificial climate houses, and the immunization procedures of all broilers were strictly performed according to broiler production standards. At 15 d, they were randomly divided into control group (CS0 group), 3h cold stimulation group (CS3 group) and 5 h cold stimulation group (CS5 group). Each group had five replicates with 16 broilers per replicate.
All broilers were initially housed at the constant temperature from 1 to 14 d, maintained at 35°C from 1 to 3d, and then gradually decreased by 1°C every 2 days. From 15 to 49 d, CS0 group remained at the normal rearing temperature. This temperature was reduced by 0.5°C per day until reaching 20°C on 33 d, and it was maintained at this temperature until 49 d. However, CS3 and CS5 groups were exposed to intermittent cold stimulation at a temperature of 3°C lower than that of CS0 group from 9:30 am on the 15 d. The duration of cold stimulation was 3 hours for the CS3 group and 5 hours for the CS5 group, occurring once every two days until 35 d. From 36 d to 49 d, the temperature was maintained at 20°C in all three groups. At 50 d, all three groups were subjected to ACS for 12 hours (Y12), with the rearing temperature reduced to 10°C at 9:30 am. The specific rearing temperature was shown in Figure 1.

Sample collection

One broiler from each group per replicate was randomly selected (n = 5 each group) and sacrificed by neck dissection at 36 d, 50 d and after ACS for 12h (Y12). Blood samples were collected in 10 mL centrifuge tubes and centrifuged at 1,500×g for 10 min at 4°C to separate serum for subsequent Enzyme-Linked Immunosorbent Assay (ELISA) tests. After dissection, the hearts of broiler were quickly collected in EP tubes, snap frozen in liquid nitrogen, and then frozen at −80°C for subsequent quantitative polymerase chain reaction (qPCR) detection and Western blot experiments.

Enzyme-linked immunosorbent assay

Serum T3 and CORT levels in each group at 36 d, 50 d and Y12 were measured using ELISA kits (Xinle Biotechnology; Shanghai, China) according to the manufacturer’s instructions. The absorbance (OD) of each serum sample at 450 nm was measured using a microplate reader (Roche, Basel, Switzerland), and the levels of T3 and CORT were calculated.

RNA extraction and gene expression assays

Total RNA was extracted from broiler heart samples using Trizol (Takara, Kusatsu, Japan) following the manufacturer’s instructions. The extracted RNA was reverse transcribed to synthesize cDNA using ReverTra Ace qPCR RT Master Mix and gDNA Remover (Toyobo, Osaka, Japan) as per the provided instructions, and stored at −80°C.
The primers were designed with Primer Premier 5.0 (Premier Biosoft International, Palo Alto, CA, USA) and synthesized by Biotechnology company (Sangon, Shanghai, China). The primer sequences of the related genes were shown in Table 1.
The qPCR amplification was performed using a Light Cycler 96 qPCR system (Roche). The reaction used a 10 μL mixture, including 5 μL of the Roche Fast Universal SYBR Green Master kit (Toyobo), 1 μL of cDNA sample, 0.3 μL of forward and reverse primers, and 3.4 μL of DEPC water [16]. The relative mRNA expression levels of the target genes were calculated by the 2 −ΔΔCT method, with the β-actin gene as an internal reference.

Tissue protein extraction and western blot analysis

Total protein was extracted from frozen broiler heart tissue samples using Western IP cell lysate (SparkJade, Harbin, China) with 1% phenyl methane sulfonylfluoride (PMSF) (SparkJade, Shandong, China). Protein concentrations were quantified using the BCA Protein Assay kit (SparkJade) and adjusted to the same concentration (4 μg/μL). The same volume (10 μL) of total protein was plated onto a 10% gel (SparkJade) for sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). Proteins were transferred to nitrocellulose membranes (SparkJade) using a semi-dry transfer device (Amersham Biosciences, Boston, MA, USA). After blocking the nitrocellulose membrane with 5% skim milk for 2 h at 37°C, the membrane was incubated with specific primary antibodies at 4°C overnight, and the diluted ratio of primary antibodies were shown in Table 2. Following primary antibody incubation, second antibody IgG-HRP was incubated (1:9,000; ZEN-BIOSCIENCE, Chengdu, China). The protein bands were observed on a gray-scale scanner (Gene Gnome XRQ, Cambridge, UK) using the ECL chemiluminescence kit (SparkJade). Finally, Image J (NIH, Bethesda, MD, USA) was employed to analyze the gray scale of the bands, and the ratio of the gray value of each target protein to the gray value of β-actin protein was calculated to represent the relative expression of the target protein.

Statistics analysis

Data were analyzed using IBM SPSS Statistics 21.0 (IBM, Armonk, NY, USA). After assessment of a normal data distribution with the Kolmogorov-Smirnov test, One-way ANOVA was used to analyze the difference and Duncan's test was used for multiple comparisons. All results were expressed as "mean±standard error of means". A p-value of <0.05 was considered significant.

RESULTS

Effects of intermittent cold stimulation and acute cold stress on neuroendocrine hormones levels

The effects of intermittent cold stimulation on neuroendocrine hormones levels are shown in Figures 2A, 2B. At 36 d, CS0 group and CS5 group had significantly higher levels of T3 hormone than CS3 group (p<0.05). CS0 had a significant higher level of CORT than CS3 group (p<0.05). However, there were no significant differences in CORT level between CS0 group and CS5 group (p<0.05).
The effects of ACS on neuroendocrine hormones levels are shown in Figures 2C, 2D. At 50 d, CS5 group had a significantly higher level of T3 hormone than CS0 group and CS3 group (p<0.05). The levels of CORT in CS0 and CS3 groups were significantly higher than CS5 group (p<0.05). However, there were no significant differences in the levels of T3 and CORT between CS0 group and CS3 group (p>0.05). At Y12, T3 level of broilers was positively correlated with the duration of intermittent cold stimulation, and there was significant difference among three groups (p<0.05). The CORT level in CS0 group was significantly higher than that in CS3 and CS5 groups (p<0.05). Compared with the 50 d, only the CORT level in CS3 group decreased significantly (p<0.05). The level of T3 did not change significantly among the three groups between 50d and Y12 (p>0.05).

Effects of intermittent cold stimulation on mRNA and protein expression levels of AMPK pathway genes

The effects of intermittent cold stimulation on mRNA expression levels of AMPKα pathway genes in the heart of broilers were shown in Figures 3A–3E. At 36 d, the AMPKα and ACO mRNA levels in CS0 group were extremely higher than CS3 and CS5 groups (p<0.05). The expression levels of AMPKα, PPARα, CPT1 and ACO mRNA in CS3 group were significantly lower than that in CS5 group (p<0.05), while the expression level of Liver Kinase B1 (LKB1) mRNA was significantly higher than that in CS5 group (p<0.05).
The effects of intermittent cold stimulation on protein expression levels of AMPK pathway genes were shown in Figures 3F–3H. At 36 d, the p-AMPKα/AMPKα ratio in CS0 group was significantly higher than that in CS5 group (p<0.05), while there was no significant difference compared with CS3 group (p<0.05). The expression level of PPARα protein in three groups significantly decreased first and then significantly increased with the duration of the intermittent cold stimulation, and there was significant difference among three groups (p<0.05).

Effects of intermittent cold stimulation on mRNA and protein expression levels of mTOR pathway genes

The effects of intermittent cold stimulation on mRNA expression levels of mTOR pathway related genes are shown in Figures 4A–4F. At 36d, mTOR, SREBP, SCD, ACC and fatty acid synthase (FAS) mRNA expression levels in CS0 group were significantly higher than CS3 group and CS5 group (p<0.05), while mRNA expression levels of tuberous sclerosis complex (TSC) were not significantly different among three groups (p>0.05).
The effects of intermittent cold stimulation on protein expression ratio of mTOR pathway related genes are shown in Figures 4G–4I. At 36–d, the expression levels of SREBP and FAS protein in CS3 group and CS5 group were significantly lower than those in CS0 group (p<0.05). In CS3 group, the expression level of SREBP was significantly lower than that in CS5 group (p<0.05), while the expression level of FAS was significantly higher than that in CS5 group (p<0.05).

Effects of acute cold stress on mRNA and protein expression levels of AMPK pathway genes

The effects of ACS on mRNA expression levels of AMPK pathway related genes were shown in Figures 5A–5E. At 50d, compared to CS0 group, the LKB1 mRNA expression levels in CS3 and CS5 group were significant decreased (p<0.05). The AMPKα mRNA expression level in CS0 group was not significantly different from that in CS3 and CS5 groups, but CS3 group had a significantly higher AMPKα mRNA expression level than that in CS5 group (p<0.05). The expression levels of PPARα, ACO and CPT1 mRNA in CS5 group were significantly higher than those in CS0 group and CS3 group (p<0.05). However, there were no significant differences in the expression of ACO and PPARα mRNA between CS3 group and CS0 group (p>0.05). At Y12, the expression level of LKB1 mRNA in CS3 group was significantly lower than that in CS0 group and CS5 group (p<0.05), while the expression levels of CPT1 mRNA were no significant differences between CS0 group and CS5 group (p>0.05). There were no significant differences in the mRNA expression levels of AMPKα and PPARα among the three groups (p>0.05). The expression levels of CPT1 and ACO mRNA in CS5 group were significantly higher than those in CS0 and CS3 groups (p<0.05). Compared with 50d, AMPKα and PPARα mRNA expression levels in CS0 group were significantly decreased (p<0.05). LKB1, AMPKα, CPT1 and ACO mRNA expression levels in CS3 group were significantly decreased (p<0.05). AMPKα, PPARα, CPT1 and ACO mRNA expression levels in CS5 group were significantly decreased (p<0.05).
The effects of ACS on protein expression levels of AMPK pathway related genes were shown in Figures 5F–5H. At 50 d, the expression of p-AMPKα/AMPKα was positively correlated with the duration of intermittent cold stimulation, and there was significant difference among three groups (p<0.05). The expression level of PPARα protein in CS5 group was significantly higher than that in CS0 and CS3 groups (p<0.05). At Y12, the expression of p-AMPKα/AMPKα in CS5 group was significantly higher than that in CS0 and CS3 groups (p<0.05). The protein expression of p-AMPKα /AMPKα in CS3 group was significantly higher than that in CS0 groups (p<0.05). The expression levels of PPARα in CS0 group and CS5 group were significantly higher than CS3 group (p>0.05). Compared with 50d, the expression of p-AMPKα/AMPKα was significantly increased among three groups (p<0.05). The protein expression of PPARα was significantly increased in CS0 group (p<0.05), significantly decreased in CS3 group (p<0.05), while no significant difference was observed in CS5 group (p>0.05).

Effects of acute cold stress on mRNA and protein expression levels of mTOR pathway related genes

The effects of ACS on mRNA expression levels of mTOR pathway related genes were shown in Figures 6A–6F. At 50d, CS5 group had significantly higher TSC, SREBP and SCD mRNA expression levels than CS0 group (p<0.05), but there were no significantly differences between CS5 and CS3 groups (p<0.05). CS3 group had a significantly higher mTOR mRNA expression level than CS5 group (p<0.05), and a significantly higher FAS mRNA expression level than other groups (p<0.05). CS0 group had a significantly higher ACC mRNA expression level than CS3 group and CS5 group (p<0.05), but there were no significant differences between CS3 group and CS5 group (p<0.05). At Y12, CS5 group had significantly higher expression levels of TSC, SREBP and SCD mRNA than CS0 group and CS3 group (p<0.05). There were no significant differences in the expression levels of mTOR, ACC and FAS mRNA among three groups (p<0.05). Compared with 50d, the expression levels of TSC, mTOR and ACC mRNA in CS0 group were significantly decreased (p<0.05). The expression levels of TSC and FAS mRNA in the CS3 group were significantly decreased (p<0.05), while the expression levels of mTOR, SREBP, SCD and ACC mRNA had no significant difference (p>0.05). The expression levels of SREBP and SCD mRNA in CS5 group were significantly increased (p<0.05), while the expression levels of mTOR, ACC and FAS mRNA had no significant difference (p<0.05).
The effects of ACS on protein expression levels of mTOR pathway related genes were shown in Figures 6G–6I. At 50d, the protein expression of SREBP was positively correlated with the duration of intermittent cold stimulation among the three groups (p<0.05), while the expression level of FAS protein was negatively correlated with the duration of intermittent cold stimulation among the three groups (p<0.05). At Y12, the expression levels of SREBP and FAS protein in CS5 group were significantly higher than CS0 group (p<0.05), while those in CS3 group were significantly lower than CS0 group (p<0.05). Compared with 50d, the expression levels of SREBP and FAS protein in CS0 and CS3 groups were significantly decreased (p<0.05), while the expression level of SREBP protein in CS5 group had no significant difference (p<0.05) and the expression level of FAS protein in the CS5 group was significantly increased (p<0.05).

DISCUSSION

The heart requires a significant amount of energy to maintain its contractile activity. Fatty acids are the preferred substrate for energy metabolism in the heart, with over 70% of energy derived from them [17]. As an organ with high lipid metabolic rate, the heart needs to maintain a high energy conversion efficiency for effective contraction in a low temperature environment [18]. Therefore, heart lipid metabolism is one of the important factors in adapting to cold environments and meeting specific energy demands. However, it remains unclear whether intermittent cold stimulation directly impacts broilers heart lipid metabolism and subsequently their adaptability to ACS.
Evidence suggests that the activity of hormones and molecules related to energy metabolism undergoes seasonal or temperature-induced changes. These processes are crucial for maintaining body temperature and generating heat in warm-blooded animals in cold temperature [19]. T3 is the active metabolite of thyroid hormone. Research indicates that in cold environments, T3 can significantly upregulate the expression of Uncoupling protein 1 (UCP1), leading to the uncoupling of ATP synthesis from oxidative phosphorylation, resulting in the release of energy in the form of heat. Therefore, the increase in T3 concentration in cold environments is believed to contribute to improved cold tolerance in animals [20]. CORT, the primary glucocorticoid in birds, increases under stress conditions to mobilize energy resources for survival, but prolonged exposure to high levels can negatively affect cellular immunity and production performance in broilers [11,21]. In present study, at 36d, both T3 and CORT concentrations in the CS3 group were significantly lower than in the CS0 group, while there were no significant differences in these indicators between the CS5 group and the CS0 group. This suggests that the intermittent cold stimulation protocol is mild and does not activate the HPT axis and HPA axis in broilers. Additionally, research by Wen et al. demonstrates that cold acclimation at 5°C significantly increases serum T3 level in striped hamsters and significantly enhances mitochondrial state-4 respiration and lipid breakdown capacity to maintain body temperature, providing further evidence for the involvement of T3 hormone in the cold acclimation process [22]. At Y12, the T3 levels in the CS3 group and CS5 group were significantly higher than that in the CS0 group. Therefore, we believe that broilers subjected to intermittent cold stimulation in the early stage can quickly activate the HPT axis under ACS conditions to regulate internal energy allocation and adapt to ACS. Ge et al. found that mice exposed to 4°C for 5 hours exhibited significantly higher plasma CORT levels compared to mice kept at room temperature (25°C), accompanied by an increase in the organism's anti-inflammatory levels. This to some extent enhanced the cold adaptability of the mice [23]. However, in a study by Hu, a high level of CORT can induce stress responses in broilers [24]. In present study, at Y12, the CORT levels in the CS3 group and CS5 group were significantly lower than that in the CS0 group. This may be because broilers in the CS3 and CS5 groups may have already adapted to the cold, resulting in a lower degree of activation of the HPA axis and thus not eliciting intense stress responses.
AMPK, a phylogenetically conserved serine/threonine protein kinase, is gaining attention as a crucial pathway for intracellular energy regulation. Its activation relies on the upstream phosphorylation of the α subunit at Thr-172 by LKB1. AMPK activation in the heart leads to downstream changes in gene expression, regulating fatty acid oxidation, glucose transport and protein metabolism, thereby increasing ATP production [25]. PPARα, a downstream gene of AMPKα, maintains cellular energy homeostasis by enhancing the expression of key genes involved in β-oxidation [26]. Experimental evidence demonstrates that mice with chronic AMPK activation exhibit high fatty acid oxidation capacity, leading to decreased triglyceride (TG) levels in the liver [27]. In the study by Wu, crayfish subjected to 9°C cold stress showed significant upregulation of AMPKα gene expression in the hepatopancreas, accompanied by downregulation of lipogenesis gene expression [28]. Furthermore, increased phosphorylation levels of AMPKα can mediate mitochondrial homeostasis, promote the function of CPT1 in fatty acid transport, and alleviate energy stress induced by low temperatures in pigs [29]. In the present study, contrary to previous research results, at 36d, mRNA levels of AMPKα and ACO, as well as the protein level of PPARα in the hearts of broilers in the CS3 and CS5 groups, were significantly reduced compared to those in the CS0 group. This indicates that the AMPK pathway in the hearts of broilers in the CS3 and CS5 groups was not activated, suggesting that intermittent mild cold stimulation does not affect the lipid decomposition capacity of broilers hearts. However, at Y12, compared to the CS0 and CS3 groups, mRNA levels of CPT1 and ACO, as well as the p-AMPKα/AMPKα protein level, were significantly upregulated in the CS5 group. In summary, compared to the CS0 and CS3 groups, the CS5 group is capable of decomposing more lipids for energy supply during ACS, thus preventing lipid metabolism disorders in the heart and maintaining normal function.
It is generally believed that the activation of AMPKα can stimulate TSC, thereby inhibiting the expression of mTOR and suppressing the synthesis of intracellular fatty acids [30]. As a downstream molecule of mTOR, SREBP maintains lipid metabolic homeostasis by positively regulating FAS and ACC [31]. ACC catalyzes the first step in FAS, converting acetyl-CoA to malonyl-CoA, while FAS synthesizes long-chain fatty acids from acetyl-CoA and malonyl-CoA. Therefore, the levels and activity of ACC and FAS determine the capacity for FAS [32,33]. Wang's research found that sustained activation of AMPKα in cold environments attenuates hepatic cell autophagy and apoptosis mediated by the PI3K/mTOR pathway, thereby enhancing the ability of fish to cope with cold stress [34]. Moreover, studies have shown that mTOR knockout in mice leads to disruptions in heart lipid metabolism and dysfunction [35]. Additionally, cold acclimation inhibits the activity of ACC and FAS in the liver of animals, enabling the liver to maintain its capacity to regulate lipid metabolism under high energy demand [32]. At 36d, except for TSC, all other mTOR pathway genes in the CS3 and CS5 groups were significantly lower than those in the CS0 group. This indicates that the intermittent cold stimulation can effectively induce adaptive changes in lipid synthesis metabolism in the hearts of broilers, thereby maintaining the energy homeostasis of broilers to adapt to cold stress. However, at Y12, compared to the 50d, the mRNA levels of mTOR and ACC were significantly downregulated in the CS0 group, while the mRNA and protein levels of FAS were significantly downregulated in the CS3 group. This indicates that the synthesis metabolism of heart fat in both CS0 and CS3 groups of broilers was inhibited by ACS.
Research has shown that the SREBP-SCD axis regulates the biosynthesis of monounsaturated fatty acids, thereby modulating the fluidity of cell membranes to maintain critical biophysical properties [36]. Additionally, the expression of the SCD gene is closely associated with low temperatures and plays a significant role in enhancing the adaptability of organisms [37]. In present study, at Y12, the mRNA expression level of SCD in the CS5 group was significantly higher than CS0 and CS3 groups, and significantly increased compared to 50d. This suggests that broilers subjected to intermittent cold stimulation can effectively mobilize the SREBP-SCD axis in the heart during ACS to enhance cell membrane fluidity and resist cold stress damage.
It is worth noting that studies have shown that hormones from both the HPA and HPT axes can activate the AMPK/mTOR pathway [20,38,39]. Research has revealed that CORT upregulates the gene expression of the AMPKα and mTOR in broilers [24]. Additionally, T3 enhances β-oxidation in mice primary brown adipocytes while diminishing mTOR activity [8]. However, the potential link between cold stress, neuroendocrine responses and heart lipid metabolism requires further investigation. In this study, at Y12, both the CS3 and CS5 groups exhibited significantly higher levels of T3 hormone and p-AMPKα/AMPKα compared to the CS0 group, while the CORT levels in CS3 and CS5 groups were significantly lower than in the CS0 group. Therefore, we speculate that it may be T3 rather than CORT that mediates the changes in gene expression of the AMPK pathway in the hearts of broilers under cold stress, thereby affecting heart fatty acid oxidation capacity. However, the specific regulatory mechanisms involved require further investigation.

CONCLUSION

The findings of present study showed that intermittent cold stimulation at 3°C lower than the normal rearing temperature for 5 h can regulate hormone levels of the HPT and HPA axis, activate AMPK pathway and inhibit the mTOR pathway to maintain their heart lipid metabolism homeostasis. However, the above regulating effects were not significant with intermittent cold stimulation for 3h. Thus, intermittent cold stimulation at 3°C lower than the normal rearing temperature for 5h could help broilers adapt to the cold temperature environment by promoting heart lipid metabolism.

Notes

CONFLICT OF INTEREST

No potential conflict of interest relevant to this article was reported.

AUTHORS' CONTRIBUTIONS

Conceptualization: Zhang Y.

Data curation: Zhang Y, Chang M.

Formal analysis: Xue Q, Wang H.

Methodology: Zhang Y, Chang M

Validation: Liu Y

Writing - original draft: Zhang Y.

Writing - review & editing: Zhang Y, Chang M, Xue Q, Wang H, Liu Y, Wei H, Li J .

FUNDING

This work was supported by the National Natural Science Foundation of China (Grant No. 32172785).

ACKNOWLEDGMENTS

The authors thank the Animal Behavior and Welfare Laboratory for its technical and human support in Northeast Agricultural University.

SUPPLEMENTARY MATERIAL

Not applicable.

DATA AVAILABILITY

Upon reasonable request, the datasets of this study can be available from the corresponding author.

ETHICS APPROVAL

All experimental procedures performed in this study were approved by the Animal Care and Use Committee of Northeast Agricultural University (IACUCNEAU20150616).

Figure 1
The specific rearing temperature. ACS, acute cold stress; Y12, ACS at 10°C for 12h from 9:30 am.
ab-24-0389f1.jpg
Figure 2
Effects of intermittent cold stimulation and ACS on neuroendocrine hormones levels in broilers. (A), (B) Effect of intermittent cold stimulation, (C), (D) effect of ACS. T3, liothyronine; CORT, corticosterone; ACS, acute cold stress. a–c The difference between the treatment groups was statistically significant (p<0.05). x,y Represent the difference between the same treatment group at 50–d and Y12 (p<0.05).
ab-24-0389f2.jpg
Figure 3
Effects of intermittent cold stimulation on mRNA and protein expression levels of AMPK pathway genes in broiler hearts.(A)–(E) Effect of intermittent cold stimulation on mRNA expression levels, (F)–(H) effect of intermittent cold stimulation on protein expression levels a–c The difference between the treatment groups was statistically significant (p<0.05). LKB1, Liver Kinase B1; AMPKα,adenosine monophosphate-activated protein kinase; PPARα, proliferators-activated receptor α; CPT1, carnitine palmitoyltransferase1; ACO, acyl -CoA oxidase; p-AMPKα, Phospho-AMPKα.
ab-24-0389f3.jpg
Figure 4
Effects of intermittent cold stimulation on mRNA and protein expression levels of mTOR pathway related genes in broiler hearts. (A)–(F) Effect of intermittent cold stimulation on mRNA expression levels, (G)–(I) effect of intermittent cold stimulation on protein expression levels. TSC, tuberous sclerosis complex; FAS, fatty acid synthase. a–c The difference between the treatment groups was statistically significant (p<0.05).
ab-24-0389f4.jpg
Figure 5
Effect of ACS on mRNA and protein expression levels of AMPK pathway related genes in broiler hearts. (A)–(E) Effect of ACS on mRNA expression levels. (F)–(H) effect of ACS on protein expression levels. a–c The difference between the treatment groups was statistically significant (p<0.05). x,y Represent the difference between the same treatment group at 50 d and Y12 (p<0.05). LKB1, Liver Kinase B1; AMPKα,adenosine monophosphate-activated protein kinase; PPARα, proliferators-activated receptor α; CPT1, carnitine palmitoyltransferase1;ACO, acyl-CoA oxidase; p-AMPKα, Phospho-AMPKα; ACS, acute cold stress
ab-24-0389f5.jpg
Figure 6
Effect of ACS on mRNA and protein expression levels of mTOR pathway related genes in broiler hearts. (A)–(F) Effect of ACS on mRNA expression levels. (G)–(I) Effect of ACS on protein expression levels. TSC, tuberous sclerosis complex; FAS, fatty acid synthase. a–c The difference between the treatment groups was statistically significant (p<0.05). x,y Represent the difference between the same treatment group at 50 d and Y12 (p<0.05). mTOR, mammalian target of rapamycin; SREBP, sterol-regulatory element binding protein; SCD, stearoyl-coA desaturase; ACC, acetyl-coA carboxylase; ACS, acute cold stress.
ab-24-0389f6.jpg
Table 1
qPCR primers sequence
Genes Serial number Primer sequence (5’ - 3’)
AMPKα NM_001039603.1 Forward: CGGAGATAAACAGAAGCACGAG
Reverse: CGATTCAGGATCTTCACTGCAAC
SREBP AY029224 Forward: GCCCTCTGTGCCTTTGTCTTC
Reverse: ACTCAGCCATGATGCTTCTTCC
PPARα NM_001001464 Forward: CAAACCAACCATCCTGACGAT
Reverse: GGAGGTCAGCCATTTTTTGGA
ACO NM_001185039 Forward: GATTTTTTGCAGGCGGGTATT
Reverse: CACACGCTGGTTCACCTGAGT
ACC NM_205505 Forward: GCTGGGTTGAGCGACTAATG
Reverse: GGGAAACTGGCAAAGGACTG
FAS NM_205155 Forward: TGAAGGACCTTATCGCATTGC
Reverse: GCATGGGAAGCATTTTGTTGT
SCD NM_204890.2 Forward: CAAGTTCTCCGAGACGCATG
Reverse: GGGCTTGTAGTATCTCCGCT
CPT1 NM_001012898 Forward: GCCCTGATGCCTTCATTCAA
Reverse: ATTTTCCCATGTCTCGGTAGTGA
LKB1 NM_001045833.1 Forward: GGACAGGTGCCTGAGGAGGAG
Reverse: GGTGGAGAGCTTGCGGATCTTG
TSC1 NC_006104.5 Forward:TCCCACTGACTGTAGGTTCACTCC
Reverse:CATGCTCATCACACTGGCTCTCAC
mTOR NC_006108.5 Forward: GAAGTCCTGCGCGAGCATAAG
Reverse: TTTGTGTCCATCAGCCTCCAGT
β-actin NM_205518.1 Forward: CACCACAGCCGAGAGAGAAAT
Reverse: TGACCATCAGGGAGTTCATAGC

qPCR, quantitative polymerase chain reaction.

Table 2
The dilution ratio of antibodies used in the current study
Antibody name Dilution ratio
AMPKα (Wanleibio, Shenyang, China) 1:1,000
p-AMPKα (Wanleibio, Shenyang, China) 1:500
PPARα (Wanleibio, Shenyang, China) 1:1,000
SREBP (Wanleibio, Shenyang, China) 1:1,000
FAS (Wanleibio, Shenyang, China) 1:500
T β-actin (Zenbio, Chengdu, China) 1:9,000

REFERENCES

1. Kong X, Liu H, He X, Sun Y, Ge W. Unraveling the mystery of cold stress-induced myocardial injury. Front Physiol 2020;11:580811. https://doi.org/10.3389/fphys.2020.580811
crossref pmid pmc
2. Mohammadalipour R, Rahmani HR, Jahanian R, Riasi A, Mohammadalipour M, Nili N. Effect of early feed restriction on physiological responses, performance and ascites incidence in broiler chickens raised in normal or cold environment. Animal 2017;11:219–26. https://doi.org/10.1017/S1751731116001555
crossref pmid
3. Nord A, Hegemann A, Folkow LP. Reduced immune responsiveness contributes to winter energy conservation in an Arctic bird. J Exp Biol. 2020. 223:jeb219287https://doi.org/10.1242/jeb.219287
crossref pmid
4. Li C, Peng M, Liao M, et al. Effects of N-acetylcysteine on the energy status and antioxidant capacity in heart and liver of cold-stressed broilers. Asian-Australas J Anim Sci 2020;33:1444–54. https://doi.org/10.5713/ajas.19.0542
crossref pmid
5. Li YC, Qiao JY, Wang BY, Bai M, Shen JD, Cheng YX. Paeoniflorin ameliorates fructose-induced insulin resistance and hepatic steatosis by activating LKB1/AMPK and AKT pathways. Nutrients 2018;10:1024. https://doi.org/10.3390/nu10081024
crossref pmid pmc
6. Tran LT, Park S, Kim SK, Lee JS, Kim KW, Kwon O. Hypothalamic control of energy expenditure and thermogenesis. Exp Mol Med 2022;54:358–69. https://doi.org/10.1038/s12276-022-00741-z
crossref pmid pmc
7. Feng JH, Sim SM, Park JS, Hong JS, Suh H. Modulation of corticosterone and changes of signal molecules in the HPA axis after cold water swimming stress. Anim Cells Syst 2021;25:37–45. https://doi.org/10.1080/19768354.2021.1890211
crossref
8. Yau WW, Singh BK, Lesmana R, et al. Thyroid hormone (T3) stimulates brown adipose tissue activation via mitochondrial biogenesis and MTOR-mediated mitophagy. Autophagy 2019;15:131–50. https://doi.org/10.1080/15548627.2018.1511263
crossref pmid
9. Xie S, Yang X, Gao Y, et al. Performance differences of Rhode Island Red, Bashang Long-tail chicken, and their reciprocal crossbreds under natural cold stress. Asian-Australas J Anim Sci 2017;30:1507–14. https://doi.org/10.1016/j.psj.2021.101294
crossref pmid pmc
10. Wang B, Cheng KK. Hypothalamic AMPK as a mediator of hormonal regulation of energy balance. Int J Mol Sci 2018;19:3552. https://doi.org/10.3390/ijms19113552
crossref pmid pmc
11. Zhou Z, Zhang A, Liu X, Yang Y, Zhao R, Jia Y. m6A-mediated PPARA translational suppression contributes to corticosterone-induced visceral fat deposition in chickens. Int J Mol Sci 2022;23:15761. https://doi.org/10.3390/ijms232415761
crossref pmid pmc
12. Lee JY, Kim H, Jeong Y, Kang CH. Lactic acid bacteria exert a hepatoprotective effect against ethanol-induced liver injury in HepG2 Cells. Microorganisms 2021;9:1844. https://doi.org/10.3390/microorganisms9091844
crossref pmid pmc
13. Dai J, Wang H, Liao Y, et al. RNA-seq and LC-MS/MS analysis of antiviral effects mediated by cold stress and stress hormone corticosterone in chicken DF-1 cells. Vet Microbiol 2022;275:109580. https://doi.org/10.1016/j.vetmic.2022.109580
crossref pmid
14. Liu Y, Xing L, Zhang Y, et al. Mild Intermittent cold stimulation affects cardiac substance metabolism via the neuroendocrine pathway in broilers. Animals 2023;13:3577. https://doi.org/10.3390/ani13223577
crossref pmid pmc
15. Wei H, Zhang Y, Li T, et al. Intermittent mild cold stimulation alleviates cold stress-induced pulmonary fibrosis by inhibiting the TGF-β1/Smad signaling pathway in broilers. Poult Sci 2024;103:103246. https://doi.org/10.1016/j.psj.2023.103246
crossref pmid
16. Li T, Wei H, Zhang S, et al. Intermittent cold stimulation affects energy metabolism and improves stress resistance in broiler heart. Poult Sci 2024;103:103190. https://doi.org/10.1016/j.psj.2023.103190
crossref pmid
17. Murashige D, Jang C, Neinast M, et al. Comprehensive quantification of fuel use by the failing and nonfailing human heart. Science 2020;370:364–8. https://doi.org/10.1126/science.abc8861
crossref pmid pmc
18. Dong HW, Zhang LF, Bao SL. AMPK regulates energy metabolism through the SIRT1 signaling pathway to improve myocardial hypertrophy. Eur Rev Med Pharmacol Sci 2018;22:2757–66. https://doi.org/10.26355/eurrev_201805_14973
crossref pmid
19. Hoarau M, Angelier F, Touzalin F, Zgirski T, Parenteau C, Legagneux P. Corticosterone: foraging and fattening puppet master in pre-breeding greylag geese. Physiol Behav 2022;246:113666. https://doi.org/10.1016/j.physbeh.2021.113666
crossref pmid
20. Rial-Pensado E, Canaple L, Guyot R, et al. Neuronal blockade of thyroid hormone signaling increases sensitivity to diet-induced obesity in adult male mice. Endocrinology. 2023. 164:bqad034https://doi.org/10.1210/endocr/bqad034
crossref pmid
21. Brown CLJ, Zaytsoff SJM, Montina T, Inglis GD. Corticosterone-mediated physiological stress alters liver, kidney, and breast muscle metabolomic profiles in chickens. Animals 2021;11:3056. https://doi.org/10.3390/ani11113056
crossref pmid pmc
22. Wen J, Qiao QG, Zhao ZJ, et al. Effects of thyroid hormones and cold acclimation on the energy metabolism of the striped hamster (Cricetulus barabensis). J Comp Physiol B 2019;189:153–65. https://doi.org/10.1007/s00360-018-1197-7
crossref pmid
23. Ge N, Westbrook R, Langdon J, et al. Plasma levels of corticosterone, tumor necrosis factor receptor 1 and interleukin 6 are influenced by age, sex and chronic inflammation in mice treated with acute temperature stress. Exp Gerontol 2020;142:111136. https://doi.org/10.1016/j.exger.2020.111136
crossref pmid pmc
24. Hu X, Cai Y, Kong L, Lin H, Song Z, Buyse J. Effects of dietary corticosterone on the central adenosine monophosphate-activated protein kinase (AMPK) signaling pathway in broiler chickens. J Anim Sci. 2020. 98:skaa202https://doi.org/10.1093/jas/skaa202
crossref pmid pmc
25. Li FH, Huang XL, Wang H, Guo SW, Li P. Protective effect of Yi-Qi-Huo-Xue Decoction against ischemic heart disease by regulating cardiac lipid metabolism. Chin J Nat Med 2020;18:779–92. https://doi.org/10.1016/S1875-5364(20)60018-8
crossref pmid
26. Haemmerle G, Moustafa T, Woelkart G, et al. ATGL-mediated fat catabolism regulates cardiac mitochondrial function via PPAR-α and PGC-1. Nat Med 2011;17:1076–85. https://doi.org/10.1038/nm.2439
crossref pmid pmc
27. Foretz M, Even PC, Viollet B. AMPK activation reduces hepatic lipid content by increasing fat oxidation in vivo. Int J Mol Sci 2018;19:2826. https://doi.org/10.3390/ijms19092826
crossref pmid pmc
28. Wu D, Liu Z, Yu P, et al. Cold stress regulates lipid metabolism via AMPK signalling in Cherax quadricarinatus. J Therm Biol 2020;92:102693. https://doi.org/10.1016/j.jtherbio.2020.102693
crossref pmid
29. He W, Liu X, Feng Y, et al. Dietary fat supplementation relieves cold temperature-induced energy stress through AMPK-mediated mitochondrial homeostasis in pigs. J Anim Sci Biotechnol 2024;15:56. https://doi.org/10.1186/s40104-024-01014-7
crossref pmid pmc
30. González A, Hall MN, Lin SC, Hardie DG. AMPK and TOR: the Yin and Yang of cellular nutrient sensing and growth control. Cell Metab 2020;31:472–92. https://doi.org/10.1016/j.cmet.2020.01.015
crossref pmid
31. Chu H, Du C, Yang Y, et al. MC-LR aggravates liver lipid metabolism disorders in obese mice fed a high-fat diet via PI3K/AKT/mTOR/SREBP1 signaling pathway. Toxins 2022;14:833. https://doi.org/10.3390/toxins14120833
crossref pmid pmc
32. Sepa-Kishi DM, Katsnelson G, Bikopoulos G, Iqbal A, Ceddia RB. Cold acclimation reduces hepatic protein Kinase B and AMP-activated protein kinase phosphorylation and increases gluconeogenesis in Rats. Physiol Rep 2018;6:5e13592. https://doi.org/10.14814/phy2.13592
crossref pmid pmc
33. Yang SM, Park YK, Kim JI, Lee YH, Lee TY, Jang BC. LY3009120, a pan-Raf kinase inhibitor, inhibits adipogenesis of 3T3-L1 cells by controlling the expression and phosphorylation of C/EBP-α, PPAR-γ, STAT-3, FAS, ACC, perilipin A, and AMPK. Int J Mol Med 2018;42:3477–84. https://doi.org/10.3892/ijmm.2018.3890
crossref pmid
34. Wang D, Tian Y, Wang Q, et al. Cold stress-induced autophagy and apoptosis disorders are mainly mediated by AMPK/PPAR/PI3K/AKT/mTOR pathways. Aquaculture 2024;583:740574. https://doi.org/10.1016/j.aquaculture.2024.740574
crossref
35. Tamai T, Yamaguchi O, Hikoso S, et al. Rheb (Ras homologue enriched in brain)-dependent mammalian target of rapamycin complex 1 (mTORC1) activation becomes indispensable for cardiac hypertrophic growth after early postnatal period. J Biol Chem 2013;288:10176–87. https://doi.org/10.1074/jbc.M112.423640
crossref pmid pmc
36. Zhang JJ, Hao JJ, Zhang YR, et al. Zinc mediates the SREBP-SCD axis to regulate lipid metabolism in Caenorhabditis elegans. J Lipid Res 2017;58:1845–54. https://doi.org/10.1194/jlr.M077198
crossref pmid pmc
37. Wang C, Li A, Cong R, et al. Cis- and Trans-variations of stearoyl-CoA desaturase provide new insights into the mechanisms of diverged pattern of phenotypic plasticity for temperature adaptation in two congeneric oyster species. Mol Biol Evol. 2023. 40:msad015. https://doi.org/10.1093/molbev/msad015
crossref pmid pmc
38. Takano AP, Diniz GP, Barreto-Chaves ML. AMPK signaling pathway is rapidly activated by T3 and regulates the cardiomyocyte growth. Mol Cell Endocrinol 2013;376:43–50. https://doi.org/10.1016/j.mce.2013.05.024
crossref pmid
39. Liu L, Wang X, Jiao H, Lin H. Glucocorticoids induced high fat diet preference via activating hypothalamic AMPK signaling in chicks. Gen Comp Endocrinol 2017;249:40–7. https://doi.org/10.1016/j.ygcen.2017.02.018
crossref pmid
TOOLS
METRICS Graph View
  • 4 Web of Science
  • 4 Crossref
  • 4 Scopus
  • 2,942 View
  • 138 Download
Related articles


Editorial Office
Asian-Australasian Association of Animal Production Societies(AAAP)
Room 708 Sammo Sporex, 23, Sillim-ro 59-gil, Gwanak-gu, Seoul 08776, Korea   
TEL : +82-2-888-6558    FAX : +82-2-888-6559   
E-mail : editor@animbiosci.org               

Copyright © 2026 by Asian-Australasian Association of Animal Production Societies.

Developed in M2PI

Close layer
prev next